Specimen Information

Sample Storage
Sample ID: CCMP1486-Nm-ITS
Catalog Number: CCMP1486-Nm-ITS
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chlorarachniophyta
Class: Chlorarachniophyceae
Order: Chlorarachniales
Family: Chlorarachniaceae
Genus: Chlorarachnion
Species: Chlorarachnion cf. sp.
Sample Collection
Ocean:
Country:
State:
Region: Sargasso sea
Exact Site: Oceanus 100
Latitude: 26.1035
Longitude: -65.2363
Coordinate:
Collectors: L. Provalosori
Collectiondate: 1981-06-27
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Surface water-main station,oceanic
   
   
   
   
   
   

Sequence Details

Sequence ID: CHLOR001-07
Marker Code: ITS
Residues: 547
TGGTGAACTGAGGAAGGATCATTGCTAAATGGATCGAGCCTAGCGCCCGAGCGTAGATAGAGCGAAAACGTTGACTAAAGATAATAAACCTTGCGCATGGTAGGTGAGCCTATCAAGTTTGATTAAAGAAACCGTAACGATGGATGTCTAGGCTCCCGTATCGATGAAGAACGTAGCAGAAAGCGACATGCGATGATACGCGCATAGACCAGGATTCCGCGGACTCGTGAATCATTGAATCTTCGAACGCATATGGCGCTCAGCAGTAGAGCCGTAGCAGGCTGAGCATGCCCTGGAGTAGTGACGAGAGCTGCCATCGCTGTAGTACATCATGATACAGCGTCGTGTCCGATATCCGAGAGGAGACATCCGTCTCCCTGAGGACGGATCAAATACCGGACCCTACCCACAGAGGTGTAGGGAGAGGCTAGTTTCCCGCGCGGATCGGTTATCGATCCGCGAGCGCACAAAGTCCTACCCACGAGCAGGAGAACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAGGGATCCTTCCTCCGGTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!