Specimen Information

Sample Storage
Sample ID: P354A8
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Kalima Mwange
Taxonomy
Phylum: Ascomycota
Class: Sordariomycetes
Order: Hypocreales
Family: Bionectriaaceae
Genus: Acremonium
Species:
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Ottawa
Exact Site: Plot 35
Latitude: 45.3667
Longitude: -75.7167
Coordinate:
Collectors: Tharcisse Barasubiye
Collectiondate: 2008-07-03
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: isolated from soil
   
   
   
   
   
   

Sequence Details

Sequence ID: CEFI033-09
Marker Code: ITS
Residues: 561
ATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGTCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATCGTTGCTTCGGCGGATCCGCCCCGGCGCCCTCGGGCCCGGATCAGGCGCCCGCCGGAGACCCCAAACTCTTGTATTTCTTTAGTATCTTCTGAGTAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGCTCGGCCCGTCCCTCGCGGCGCGCCGTCCCCGAAATCCAGTGGCGGTCACGCTGTACTCCTCTGCGTAGTAATCCAACCTCGCAACGGGACAAAGCCTGGCCACGCCGTTAAACCCCCCACTTCTGAAGGTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!