Specimen Information

Sample Storage
Sample ID: HET-Blepha-spec-01
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Michaela C. Strueder-Kypke
Taxonomy
Phylum: Ciliophora
Class: Heterotrichea
Order: Heterotrichida
Family: Blepharismidae
Genus: Blepharisma
Species: Blepharisma sp.
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: Carolina Biological Supply
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: culture
   
   
   
   
   
   

Sequence Details

Sequence ID: CBOLN055-08
Marker Code: COI-5P
Residues: 734
GCCTATCCCAGGCTAAATAACCTTAGTCTTTGACTTTTACCTGCCGGTTTGATAACTGCGTTAAGAGCTCTTTGAGAGGGGATTCGTACTAGTTCTCTGAATTTTTTAACAGAATCAAATTATTCTTTTAATGAGTGAGAACGTGATCTATTTGGAAATAATATTTTTATAGCTTACGGTGATTTAAACGATTATGATTTTAATGATTATTCCTTTGATTCAGAAGCTCAAAGTTGAATACAATTAAATAGTATTAAAACTAGTGTTTCTTTATCTAGTTATATCGATTGTGATTATTTACCAGCTAATAAAGATTCATTAGCGCCATTTTTGCCCAGTATCAATGTAAATATAGATTTAACAAATACTATGGCTGGGTGAACCTTTACTACACCATTTTCTCATAGTCGTTTTACTGGTGTTCCTGTAGATTGAGCTTTAGCTGCTTTGTTAATAGCCACCCTTTCTTCTATTATTACAATAATAAATTTAATTGTTACGTGAAGATATTTACGTGGTAGAGGTTCTCGTAATCAAAAAGAATTCTTTCCGATATCATTAATATCTATTTTTATATCTTTGCGAATTTTAATTATAGTTTCTCCTATTTTAAATGCTGGTTTAATAATGCTAATTTCTGATCGTCATTTTTTTACATCCTTTTTTACGGTTAGAGCCGGTGGTGATATTTTGTTATTTCAACATATTTTTTGATTTTTCGGTCACCCTGAAGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!