Specimen Information

Sample Storage
Sample ID: A54-PM
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Eduardo Eizirik
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Carnivora
Family: Felidae
Genus: Leopardus
Species: Leopardus tigrinus
Sample Collection
Ocean:
Country: Brazil
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: Vanessa G. Graeff
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Faecal sample of unknown species
   
   
   
   
   
   

Sequence Details

Sequence ID: CAR352-11
Marker Code: atp6
Residues: 126
TTCACTACCCCAACAATAATGGGACTACCCATTGTTATCTTAATTATTATATTCCCGAGCATTCTATTTCCTTCACCCAATCGACTAATTAATAACCGCCTAGTCTCACTACAACAATGACTAGTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!