Specimen Information

Sample Storage
Sample ID: ROM 113658
Catalog Number: 113658
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Carollia
Species: Carollia perspicillata
Sample Collection
Ocean:
Country: Guyana
State: Demerara-Mahaica
Region:
Exact Site:
Latitude: 6.5
Longitude: -58.217
Coordinate:
Collectors: Lim, BK., Jafferally, DM., and Norman, Z.
Collectiondate: 2001-10-12
Specimen Details
Sex: female
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: BCBNT660-06
Marker Code: COI-5P
Residues: 657
ACCCTTTATCTTCTGTTTGGTGCTTGAGCAGGCATAGTAGGCACTGCACTAAGCCTTCTTATCCGTGCTGAGCTCGGCCAACCCGGAGCCTTATTAGGTGATGATCAGATCTATAATGTAATTGTAACAGCTCATGCCTTTGTGATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAACTGACTGATTCCTCTAATAATTGGTGCCCCTGACATAGCCTTTCCCCGAATAAACAATATAAGCTTCTGACTCCTACCTCCCTCTTTCTTATTATTACTAGCCTCTTCAACAGTCGAAGCAGGAGTAGGTACCGGCTGAACAGTATACCCACCCCTAGCAGGCAATCTCGCACATGCAGGAGCTTCTGTAGATCTAGCTATTTTTTCTCTCCACCTTGCAGGAGTCTCATCAATTCTAGGCGCTATCAACTTTATTACCACTATTATTAATATGAAGCCCCCTGCTCTCTCTCAATATCAAACACCCCTGTTCGTCTGATCTGTCCTAATTACAGCCGTCTTATTACTTCTGTCTCTTCCTGTTCTAGCAGCAGGTATCACTATACTACTAACAGACCGAAACCTTAATACCACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATCCTATATCAACACCTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!