Specimen Information

Sample Storage
Sample ID: ROM 113604
Catalog Number: 113604
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Artibeus
Species: Artibeus lituratus
Sample Collection
Ocean:
Country: Guyana
State: Upper Takutu-Upper Essequibo
Region:
Exact Site:
Latitude: 3.183
Longitude: -58.817
Coordinate:
Collectors: Lim, BK., Ci RAP., and Norman, Z.
Collectiondate: 2001-09-28
Specimen Details
Sex: male
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: BCBNT645-06
Marker Code: COI-5P
Residues: 655
ACTTTATACCTGTTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCTGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTTGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCCTTATTTGTCTGATCCGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCTGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCCATTTTATATCAACACTTAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.