Specimen Information

Sample Storage
Sample ID: ROM 109262
Catalog Number: 109262
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Artibeus
Species: Artibeus lituratus
Sample Collection
Ocean:
Country: Guyana
State: Potaro-Siparuni
Region:
Exact Site:
Latitude: 4.75
Longitude: -59.017
Coordinate:
Collectors: Lim, BK., Scully, WMR., Arjoon, JD., and Jafferally, Dm.
Collectiondate: 1997-11-18
Specimen Details
Sex: male
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: BCBNT395-06
Marker Code: COI-5P
Residues: 657
ACTTTATACCTATTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCTGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTTGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCCTTATTTGTCTGATCCGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCCGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCCATTTTATATCAACACTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.