Specimen Information

Sample Storage
Sample ID: ROM 116538
Catalog Number: 116538
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Carollia
Species: Carollia perspicillata
Sample Collection
Ocean:
Country: Guyana
State: Potaro-Siparuni
Region:
Exact Site:
Latitude: 5.25
Longitude: -59.614
Coordinate:
Collectors: Lim, BK., Jafferally, DM., and James, R.
Collectiondate: 2005-06-04
Specimen Details
Sex: female
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: BCBNC182-06
Marker Code: COI-5P
Residues: 655
ACCCTTTATCTTCTGTTTGGTGCTTGAGCAGGCATAGTAGGCACTGCACTAAGCCTTCTTATCCGTGCTGAGCTCGGCCAACCCGGAGCCTTATTAGGTGATGATCAGATCTATAATGTAATTGTAACAGCCCATGCCTTTGTGATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGCTTTGGTAACTGACTAATTCCTCTAATAATTGGTGCCCCTGACATAGCCTTTCCCCGAATAAACAATATAAGCTTCTGACTCCTACCTCCCTCTTTCTTATTATTACTAGCCTCTTCAACAGTCGAAGCAGGAGTGGGTACCGGCTGAACAGTATACCCACCCCTAGCAGGCAATCTCGCACATGCAGGAGCTTCTGTAGATCTAGCTATTTTTTCTCTCCACCTTGCAGGAGTCTCATCAATTCTAGGCGCTATCAACTTTATTACCACTATTATTAATATGAAACCCCCTGCTCTCTCTCAATATCAAACACCCCTGTTCGTCTGATCTGTCCTAATTACAGCCGTCTTATTACTTCTGTCTCTTCCTGTTCTAGCAGCAGGTATCACTATACTACTAACAGACCGAAACCTTAATACCACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATCCTATATCAACACCTAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!