Specimen Information

Sample Storage
Sample ID: GWS022744
Catalog Number: GWS022744
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Chlorophyta
Class: Ulvophyceae
Order: Ulvales
Family: Ulvaceae
Genus: Ulva
Species: Ulva fasciata
Sample Collection
Ocean:
Country: Australia
State: New South Wales
Region:
Exact Site: Lord Howe I., Neds Beach
Latitude: -31.517
Longitude: 159.067
Coordinate:
Collectors: G.W. Saunders & K. Dixon
Collectiondate: 2010-11-20
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AUSCH245-10
Marker Code: rbcL
Residues: 742
CGTGACCGTTTCTTATTTACTGCTGAAGCGATTTATAAATCTCAAGCTGAAACTGGTGAGGTTAAAGGTCATTACTTAAATGCAACAGCAGGTACATGCGAAGAAATGATGGAACGTGGTCAATTTGCTAAAGATTTAGGTGTTCCAATTATTATGCATGACTATATTACTGGTGGTTTTACAGCTAACACTTCATTAGCTCATTTCTGTCGTGCTAGTGGATTATTATTACATATTCACCGTGCTATGCACGCTGTTATTGATCGTCAACGTAATCACGGTATTCACTTCCGAGTATTAGCGAAAATTTTACGTATGTCAGGTGGTGATCACTTACATTCAGGAACAGTAGTAGGTAAATTAGAAGGTGAACGTGAAATTACTTTAGGTTTCGTTGATTTAATGCGTGATGACTACATTGAAAAAGATCGTAGTCGTGGTATCTACTTTACACAAGATTGGGTTAGTTTACCAGGTACAATGCCTGTAGCTTCAGGTGGTATTCACGTTTGGCATATGCCTGCATTAGTTGAAATTTTTGGTGATGATGCATGTTTACAATTCGGTGGTGGTACATTAGGACACCCTTGGGGTAATGCTCCAGGAGCCGCTGCAAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGAAATGAAGGACGTGATTTAGCATCTGAAGGTGGTGATGTAATTCGTGCTGCTTGTAAATGGAGTCCTGAATTAGCTGCAGCTTGTGAAGTAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!