Specimen Information

Sample Storage
Sample ID: DHJPAR0007973
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Daniel H. Janzen
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Diptera
Family: Tachinidae
Genus: Patelloa
Species: Patelloa xanthuraDHJ01
Sample Collection
Ocean:
Country: Costa Rica
State: Guanacaste
Region: Area de Conservacion Guanacaste
Exact Site: Quebrada Costa Rica
Latitude: 10.827
Longitude: -85.637
Coordinate:
Collectors: gusaneros
Collectiondate: 2001-12-15
Specimen Details
Sex:
Life Stage: adult
Reproduction: sexual
Notes: Saturniidae: Euphorbiaceae|Croton jutiapensis (Specimen also identified by: D. M. Wood)
   
   
   
   
   
   

Sequence Details

Sequence ID: ASTAT745-06
Marker Code: COI-5P
Residues: 657
ACATTATATTTTATTTTTGGAGCTTGNTCCGGAATAATTGGAACTTCATTAAGAATATTAATTCGTGTTGAATTAGGACATCCCGGTTCATTAATTGGTGATGACCAAATTTATAATGTAATTGTTACAGCCCATGCATTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGGTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTTCTTCCTCCAGCATTAACTCTTCTTTTGGCAAGCAGTATAGTTGAAAATGGGGCTGGTACAGGATGAACAGTTTACCCTCCTTTATCTTCTATTATTGCTCATGGAGGGGCATCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGAATTACATTTGATCGAATACCTTTATTTGTTTGATCTGTAGTAATTACAGCTTTATTACTATTGTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCATTCTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.