Specimen Information

Sample Storage
Sample ID: DHJPAR0037852.w
Catalog Number: 09-SRNP-14615
Voucher Type:
Voucher Description:
Institution Storing: Biodiversity Institute of Ontario
Identification Provided by: Alex Smith
Taxonomy
Phylum: Proteobacteria
Class: Alphaproteobacteria
Order: Rickettsiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Costa Rica
State: Guanacaste
Region: Area de Conservacion Guanacaste
Exact Site: Area Administrativa
Latitude: 10.838
Longitude: -85.619
Coordinate:
Collectors: Guillermo Pereira
Collectiondate: 2009-09-24
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ASEND135-10
Marker Code: COI-5P
Residues: 657
ACACTGTACATTATTTTTTCCATATTAGCTGGAATTATTGGTGGATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCATTTCCTCGTATGAATAATTTAAGTTTTTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTTTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTCTATCACAGGTAATGTCCCATCCAAGTGCAGGAGTTGACATTGCTATACTTGCACTTCATGTTGCTGGTATGTCGTCAATTGTTGGGGCGATCAACTTTATAGTTACTATATTTAACATGCGCACAAAAGGAATGTCATTAACTAAGATGCCACTGTTTGTTTGGTCTGTCTTGCTAACAGCATTTATGTTGATTGTTGCCTTACCAGTGCTTGCCGGTGCTATAACTATGCTTCTTACTGATCGCAATATTGGTACTTCCTTTTTTGATCCTGCCGGTGGCGGCGATCCTGTGTTATTTCAACATCTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!