Specimen Information

Sample Storage
Sample ID: ASHYF036-09.w
Catalog Number: DHJPAR0028274
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Alex Smith
Taxonomy
Phylum: Proteobacteria
Class: Alphaproteobacteria
Order: Rickettsiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Costa Rica
State: Guanacaste
Region: Area de Conservacion Guanacaste
Exact Site: Camino Maritza
Latitude:
Longitude:
Coordinate:
Collectors: Johan Vargas
Collectiondate: 2008-05-24
Specimen Details
Sex:
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ASEND066-09
Marker Code: COI-5P
Residues: 631
GGCTGGAATTATTGGTGGATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCGTTTCCTCGTATGAATAATTTGAGTTTCTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTCTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTTTATCACAGGTAATGTCCCATCCAAGTGCAGGAGTTGACATTGCTATACTTGCACTCCACGTTGCTGGTATGTCGTCAATTGTTGGGGCGATCAACTTTATAGTTACTATATTTAACATGCGCGCAAAAGGCATGTCATTAACTAAGATGCCACTGTTTGTTTGGTCTGTCTTGTTAACAGCATTTATGTTGATTGTTGCCTTACCAGTGCTTGCCGGTGCTATAACTATGCTTCTTACTGATCGCAATATTGGTACTTCCTTTTTTGATCCTGCCGGTGGCGGCGATCCTGTGTTATTTCAACATCTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||

Photograph

No image available currently!