Specimen Information

Sample Storage
Sample ID: ASMET183-09.w
Catalog Number: 98-SRNP-6993
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Alex Smith
Taxonomy
Phylum: Proteobacteria
Class: Alphaproteobacteria
Order: Rickettsiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Costa Rica
State: Alajuela
Region: Area de Conservacion Guanacaste
Exact Site: Vado Rio Cucaracho
Latitude: 10.87
Longitude: -85.392
Coordinate:
Collectors: Gloria Sihezar
Collectiondate: 1998-08-20
Specimen Details
Sex:
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ASEND011-09
Marker Code: COI-5P
Residues: 579
ATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCATTTCCTCGTATGAATAATTTAAGTTTTTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTCTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTCTATCACAGGTAATGTCCCATCCAAGTGCAGGAGTTGACATTGCTATACTTGCACTTCATGTTGCTGGTATGTCGTCAATTGTTGGGGCGATCAACTTTATAGTTACTATATTTAACATGCGCACAAAAGGAATGTCATTAACTAAGATGCCACTGTTTGTTTGGTCTGTCTTGCTAACAGCATTTATGTTGATTGTTGCCTTACCAGTGCTTGCCGGTGCTATAACTATGCTTCTTACTGATCGCAATATTGGTACTTCCTTTTTTGATCCTGCCGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!