Specimen Information

Sample Storage
Sample ID: DHJPAR0036153.w
Catalog Number: 02-SRNP-3939
Voucher Type:
Voucher Description:
Institution Storing: Biodiversity Institute of Ontario
Identification Provided by: Alex Smith
Taxonomy
Phylum: Proteobacteria
Class: Alphaproteobacteria
Order: Rickettsiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Costa Rica
State: Alajuela
Region: Area de Conservacion Guanacaste
Exact Site: Sendero Corredor
Latitude: 10.879
Longitude: -85.39
Coordinate:
Collectors: Gloria Sihezar
Collectiondate: 2002-07-15
Specimen Details
Sex:
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ASEND003-09
Marker Code: COI-5P
Residues: 478
TGGAATTATTGGTGGATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCATTTCCTCGTATGAATAATTTAAGTTTTTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTCTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTCTATCACAGGTAATGTCCCATCCAAGTGCAGGAGTTGACATTGCAATACTTGCACTTCATGTTGCTGGTATGTCGTCAATTGTGGGGGCGATCAACTTTATAGTTACTATATTTAACATGCGCACAAAAGGAATGTCATTAACTAAGATGCCACTGTTTGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.