Specimen Information

Sample Storage
Sample ID: ROM 116926
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Artibeus
Species: Artibeus lituratus
Sample Collection
Ocean:
Country: Suriname
State: Nickerie
Region: Sipaliwini
Exact Site:
Latitude: 4.478
Longitude: -57.042
Coordinate:
Collectors: Lim, BK; Peters, SL
Collectiondate: 2005-11-01
Specimen Details
Sex: female
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABSRA337-06
Marker Code: COI-5P
Residues: 657
ACTTTATACCTATTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCTGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTCGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCCTTATTTGTCTGATCCGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCTGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCTATTTTATATCAACACTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!