Specimen Information

Sample Storage
Sample ID: GWS001648
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: University of New Brunswick, Fredericton
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Florideophyceae
Order: Acrochaetiales
Family: Acrochaetiaceae
Genus: Acrochaetium
Species: Acrochaetium secundatum
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Bamfield, Seppings I.
Latitude: 48.839
Longitude: -125.208
Coordinate:
Collectors: Shana Rose Carter
Collectiondate: 2003-05-07
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC447-06
Marker Code: COI-5P
Residues: 664
AACATTATATCTAATTTTTGGTGCTTTTTCAGGTGTTTTAGGGGGGTGTATGTCTTTATTAATTAGAATGGAATTAGCCCAACCAGGTAATCATTTATTAATGGGTAATCACCAAGTTTACAACGTACTAATAACAGCTCACGCTTTTCTGATGATATTTTTTATGGTAATGCCTGTAATGATTGGAGGTTTTGGTAATTGGTTAGTGCCTATTATGATAGGTAGCCCAGATATGGCTTTTCCTCGACTAAACAATATTAGCTTTTGATTACTTCCTCCGTCATTGTGTTTATTATTAGCTTCTTCGTTAGTTGAAGTAGGGGCAGGTACAGGTTGAACTGTTTACCCCCCTTTAAGTTCAATACAAAGTCATTCTGGAGGTGCTGTTGACTTAGCTATTTTTAGTTTACATCTTTCAGGCGCAGCCTCAATTTTAGGAGCCATAAATTTTATCTCAACAATATTAAATATGAGAAATCCTGGCCAAAGTATGTACAGAATGCCTTTGTTTGTTTGGTCGATTTTTGTTACAGCTTTTTTACTTTTATTAGCAGTCCCAGTTTTAGCAGGAGCTATAACAATGTTACTTACCGATCGTAATTTTAACACATCTTTTTTTGACCCAGCTGGGGGAGGTGATCCGGTGTTATATCAACACCTTTTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.