Specimen Information

Sample Storage
Sample ID: GWS012785
Catalog Number: GWS012785
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Compsopogonophyceae
Order: Erythropeltidales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Burnaby Island near Saw Reef, Gwaii Haanas
Latitude: 52.449
Longitude: -131.283
Coordinate:
Collectors: GWS & D. McDevit
Collectiondate: 2009-06-19
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC4134-09
Marker Code: COI-5P
Residues: 661
GTTATACTTAATTTTTGGTGCTTTCTCTGGAGTGTTAGGCACAGTACTTAGCGTAATTATACGTATGGAATTAGCACATCCCGGCTCACAAATTTTAGCAGGAAATTATCAACTGTACAATGTTTTAATTACTAGCCATGCCTTCCTCATGATCTTCTTTTTCGTAATGCCTATAATGATAGGAGGGTTTGGTAATTGATTTGTACCTATAATGATAGGTGCTCCAGATATGGCGTTTCCAAGATTAAACAACATATCTTTTTGACTATTACCGCCTGCGCTTGTACTTTTGTTAACTTCATCACTTGTCGAATTTGGTGCTGGAACAGGGTGAACTGTTTATCCACCGTTAAGTGCGATTCAAAGTCATTCCGGAGGAGCTGTTGAACTTTGTATCTTGTCTCTTCATATTGCAGGTGCAAGTTCTATCTTAGGAGCTGTAAACTTTATTGTTACTATATTAAATATGAGAAATCCAGGCCAAGGGTATCATCGAATGCCTTTATTTGTATGATCTATATTAATTACAGCAATTTTGTTACTATTAGCAGTTCCTGTGCTTGCAGGTGCAATTACAATGCTATTAACTGATCGTAACTTTAATACAATGTTTTTTGATGCCAAAGGAGGAGGAGATCCTATACTATATCAGCATCTTTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!