Specimen Information

Sample Storage
Sample ID: GWS011055
Catalog Number: GWS011055
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Compsopogonophyceae
Order: Erythropeltidales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Tsawwassen, causeway to ferry terminal
Latitude: 49.048
Longitude: -123.125
Coordinate:
Collectors: GWS & D. McDevit
Collectiondate: 2009-06-13
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC3888-09
Marker Code: COI-5P
Residues: 661
AACGTTATACTTAATTTTTGGTGCTTTCTCTGGAGTGTTAGGCACAGTACTTAGTGTAATTATACGTATGGAATTAGCACATCCTGGCTCACAAATTTTAGCAGGAAATTATCAACTGTACAATGTTTTAATTACTAGTCATGCTTTTCTTATGATCTTTTTTTTCGTAATGCCTATAATGATAGGAGGGTTTGGTAATTGATTCGTACCTATAATGATAGGCGCTCCAGATATGGCGTTTCCAAGATTAAACAACATATCTTTTTGACTATTACCGCCTGCGCTTGTACTTTTGTTAACTTCATCACTCGTTGAATTTGGTGCTGGAACGGGGTGAACTGTTTATCCACCTTTAAGTGCGATTCAAAGTCATTCCGGAGGAGCTATCGAACTTTGTATCTTGTCTCTTCATATTGCAGGTGCAAGTTCTATCTTAGGAGCTGTAAACTTTATTGTTACCATATTAAATATGAGAAATCCAGGCCAAGGGTATCATCGAATGCCTTTATTTGTATGATCTATATTAATTACAGCAATTTTGTTACTATTAGCAGTTCCTGTGCTTGCAGGTGCAATTACAATGTTATTAACTGATCGTAACTTTAATACAATGTTTTTTGATGCTAAAGGAGGAGGAGACCCTATACTATATCAACATCTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.