Specimen Information

Sample Storage
Sample ID: GWS009979
Catalog Number: GWS009979
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia fallax
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Tahsis, Island #40 on Esperenza Inlet Chart
Latitude: 49.8125
Longitude: -126.987
Coordinate:
Collectors: GWS & B. Clarkston
Collectiondate: 2008-05-21
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC3524-08
Marker Code: COI-5P
Residues: 815
TACGTTATATTTAATTTTTGGCGCTTTTTCCGGTATATTAGGTGCGTGTGCATCAATATTAATTCGAATGGAATTAGCACAACCAGGTAATCAACTTTTACTAGGCAATCATCAAGTATACAATGTATTAGTTACAGAGCATGCATTTTTAATGATCTTTTTTATGGTAATGCCTGTATTAATTGGTGGATTTGGTAACTGATTTGTACCAATTATGATAGGGGCACCAGACATGGCTTTTCCAAGACTAAATAACATAAGCTTTTGACTATTACCTCCGTCATTATGCCTTCTCTTAGGATCTGCCATGGTCGAAGTAGGTGCTGGTACAGGGTGAACTTTATATCCTCCTCTAAGTTCTATACAGAGTCATTCAGGTGGTGCTGTAGATCTTGCTATTTTTAGTTTACATTTATCTGGTGCGTCTTCCATACTAGGTGCTATTAACTTTATTACTACTATATTTAACATGCGTAATCCTGGTCAAAGCATGTATCGTATACCTTTATTTGTTTGATCTATACTGATAACAGCTTTTTTATTATTATTAGCAGTACCTGTCTTAGCTGGAGCTATTACAATGTTATTAACTGATAGAAACTTTAATACCACATTTTTTGATCCTTCAGGTGGTGGTGATCCTGTGTTATATCAGCATTTATTTTGATTTTTCGGGCATCCAGAAGTTTACATTTTAATATTGCCTGGATTTGGTATTGTCAGTCATATTGTATCAACATTTTCTAGAAAACCTGTTTTCGGTTATATAGGAATGATTTATGCTATGCTTTCTATAGGTATTTTAGGATTTATAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.