Specimen Information

Sample Storage
Sample ID: GWS009714
Catalog Number: GWS009714
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia perforata
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: northern end of Qualicum Beach
Latitude: 49.3587
Longitude: -124.466
Coordinate:
Collectors: H. Kucera & H. Kucerova
Collectiondate: 2008-06-05
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2938-08
Marker Code: COI-5P
Residues: 262
AACTTTATATTTAATCTTTGGCGCTTTTTCCGGCATATTAGGTGCATGTGCATCTATATTAATCAGAATGGAATTAGCTCAACCTGGTAATCAATTATTGTTAGGTAATCATCAAATATACAATGTACTTGTGACGGAACATGCTTTCCTAATGATTTTTTTCATGGTTATGCCTGTATTAATTGGCGGATTTGGTAACTGATTTGTACCAATCATGATAGGTGCTCCAGATATGGCATTTCCTCGTTTAAATAATATAAGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.