Specimen Information

Sample Storage
Sample ID: GWS009630
Catalog Number: GWS009630
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia perforata
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Tahsis, Island #40 on Esperenza Inlet Chart
Latitude: 49.8125
Longitude: -126.987
Coordinate:
Collectors: GWS & B. Clarkston
Collectiondate: 2008-05-20
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2931-08
Marker Code: COI-5P
Residues: 661
TTTATATTTAATCTTTGGCGCTTTTTCCGGCATATTAGGTGCATGTGCATCTATATTAATCAGAATGGAATTAGCTCAACCTGGTAATCAATTATTGTTAGGTAATCATCAAATATACAATGTACTTGTGACGGAACATGCTTTCCTAATGATTTTTTTCATGGTTATGCCTGTATTAATTGGCGGATTTGGTAACTGATTTGTACCAATCATGATAGGTGCTCCAGATATGGCATTTCCTCGTTTAAATAATATAAGTTTCTGGTTATTACCGCCATCATTATGTCTTCTTTTAGGATCTGCCATGGTAGAAGTGGGTGCAGGTACAGGTTGAACTCTATATCCACCTTTAAGTTCTATACAAAGTCATTCAGGGGGGGCTGTAGACCTTGCTATTTTTAGTTTGCATCTATCTGGTGCTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACTATATTTAACATGCGTAATCCAGGACAAAGTATGTATCGTATACCTCTATTTGTTTGATCTATACTCATAACTGCCTTTTTATTACTACTTGCAGTGCCTGTTTTAGCTGGCGCCATTACCATGTTATTAACAGATAGAAATTTCAACACTACATTTTTTGACCCTTCAGGTGGTGGAGATCCTGTGCTTTATCAGCATCTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!