Specimen Information

Sample Storage
Sample ID: GWS006129
Catalog Number: GWS006129
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Bangia
Species: Bangia sp. 2BAN
Sample Collection
Ocean:
Country: Canada
State: Quebec
Region:
Exact Site: Escoumins (old ferry terminal)
Latitude: 48.3453
Longitude: -69.3902
Coordinate:
Collectors: GWS, D. McDevit & H. Kucera
Collectiondate: 2007-05-14
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2901-08
Marker Code: COI-5P
Residues: 661
TACATTGTATTTAATCTTTGGTGCTTTCTCAGGTATTTTAGGTGCTTGTGCATCAATACTAATTAGGATGGAATTAGCTCAACCTGGTAACCAACTGTTATTAGGTAATCATCAAGTTTATAATGTATTAGTTACAGAGCATGCTTTTCTGATGATCTTTTTCATGGTGATGCCCGTATTAATTGGTGGCTTTGGTAATTGGTTTGTACCAATCATGATAGGAGCACCAGATATGGCTTTTCCCAGATTAAATAATATTAGCTTCTGATTATTACCACCATCATTATGTCTTCTTTTGGGATCTGCTATGGTTGAAGTAGGCGCGGGTACGGGTTGAACTCTATATCCTCCTTTAAGTTCTATCCAAAGTCATTCGGGTGGAGCCGTAGATCTTGCAATTTTCAGTCTGCATTTATCTGGAGCTTCTTCAATACTAGGTGCCATTAATTTTATTACTACAATATTTAACATGCGAAACCCAGGACAAAGTATGTATCGCATACCTCTATTCGTTTGATCTATATTAATAACTGCTTTCTTACTTTTATTGGCAGTACCCGTGTTAGCAGGTGCAATTACAATGCTCTTAACAGATAGGAATTTTAATACTACATTTTTTGACCCTTCTGGAGGTGGAGACCCTGTGTTATATCAACACTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.