Specimen Information

Sample Storage
Sample ID: GWS002652
Catalog Number: GWS002652
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Bangia
Species: Bangia sp. 2BAN
Sample Collection
Ocean:
Country: Canada
State: New Brunswick
Region:
Exact Site: Letete exposed biodiversity site, Bay of Fundy
Latitude: 45.0382
Longitude: -66.8912
Coordinate:
Collectors: GWS
Collectiondate: 2005-03-14
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2888-08
Marker Code: COI-5P
Residues: 661
TACATTGTATTTAATCTTTGGTGCTTTCTCAGGTATTTTAGGTGCTTGTGCATCAATACTAATTAGGATGGAATTAGCTCAACCTGGTAACCAACTGTTATTAGGTAATCATCAAGTTTATAATGTATTAGTTACAGAGCATGCTTTTCTGATGATCTTTTTCATGGTGATGCCTGTATTAATTGGTGGCTTTGGTAATTGGTTTGTACCAATCATGATAGGAGCACCAGATATGGCTTTTCCCAGATTAAATAATATTAGCTTCTGATTATTACCACCATCATTATGTCTTCTTTTGGGATCTGCTATGGTTGAAGTAGGCGCGGGTACGGGTTGAACTCTATATCCTCCTTTAAGTTCTATCCAAAGTCATTCGGGTGGAGCCGTAGATCTTGCAATTTTCAGTCTGCATTTATCTGGAGCTTCTTCAATACTAGGTGCCATTAATTTTATTACTACAATATTTAACATGCGAAACCCAGGACAAAGTATGTATCGCATACCTCTATTCGTTTGATCTATATTAATAACTGCTTTCTTACTTTTATTGGCAGTACCCGTGTTAGCAGGTGCAATTACAATGCTCTTAACAGATAGGAATTTTAATACTACATTTTTTGACCCTTCTGGAGGTGGAGACCCTGTGTTATATCAACACTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!