Specimen Information

Sample Storage
Sample ID: GWS006445
Catalog Number: GWS006445
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia sp. 1POR
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Spring Bay
Latitude: 48.4558
Longitude: -123.269
Coordinate:
Collectors: H. Kucera
Collectiondate: 2007-05-26
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2670-08
Marker Code: COI-5P
Residues: 661
TACTTTATATTTAATTTTTGGAGCTTTCTCTGGCATATTAGGCGCATGCGCATCTATATTAATCAGAATGGAACTAGCTCAACCTGGTAATCAACTTCTATTAGGCAATCATCAAGTATACAATGTACTAGTTACAGAGCACGCTTTCTTAATGATTTTTTTTATGGTTATGCCTGTATTAATTGGAGGGTTCGGGAATTGATTTGTACCAATTATGATAGGAGCGCCAGACATGGCTTTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCCCCATCATTATGCCTTCTATTAGGTTCTGCTATGGTTGAAGTAGGTGCTGGTACAGGTTGAACTTTGTATCCACCTTTAAGTTCTATACAAAGTCATTCAGGTGGTGCTGTAGATCTTGCTATTTTTAGCTTGCATTTATCGGGTGCGTCTTCTATATTGGGTGCTATCAATTTTATTACGACCATATTTAACATGCGTAACCCAGGTCAGAGCATGTATCGTATACCTTTATTTGTTTGATCTATATTAATAACAGCTTTCTTATTGCTTTTAGCAGTACCTGTTTTAGCTGGGGCTATTACAATGCTACTAACTGATAGAAATTTCAACACTACATTTTTTGACCCTTCAGGTGGTGGTGATCCTGTGCTATACCAGCACTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!