Specimen Information

Sample Storage
Sample ID: GWS004818
Catalog Number: GWS004818
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia fallax
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Ridley Island (south of coal terrminal), Prince Rupert
Latitude: 54.2212
Longitude: -130.329
Coordinate:
Collectors: GWS, B. Clarkston & D. McDevit
Collectiondate: 2006-07-08
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2654-08
Marker Code: COI-5P
Residues: 664
TACGTTATATTTAATTTTTGGCGCTTTTTCCGGTATATTAGGTGCGTGTGCATCAATATTAATTCGAATGGAATTAGCACAACCAGGTAATCAACTTTTACTAGGCAATCATCAAGTATACAATGTATTAGTTACAGAGCATGCATTTTTAATGATCTTTTTTATGGTAATGCCTGTATTAATTGGTGGATTTGGTAACTGATTTGTACCAATTATGATAGGGGCACCAGACATGGCTTTTCCAAGACTAAATAACATAAGCTTTTGACTATTACCTCCGTCATTATGCCTTCTCTTAGGATCTGCCATGGTCGAAGTAGGTGCTGGTACAGGGTGAACTTTATATCCTCCTCTAAGTTCTATACAGAGTCATTCAGGTGGTGCTGTAGATCTTGCTATTTTTAGTTTACATTTATCTGGTGCGTCTTCCATACTAGGTGCTATTAACTTTATTACTACTATATTTAACATGCGTAATCCTGGTCAAAGCATGTATCGTATACCTTTATTTGTTTGATCTATACTGATAACAGCTTTTTTATTATTATTAGCAGTACCTGTCTTAGCTGGAGCTATTACAATGCTATTAACTGATAGAAACTTTAATACCACATTTTTTGATCCTTCAGGTGGTGGTGATCCTGTGTTATATCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!