Specimen Information

Sample Storage
Sample ID: GWS008045
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Porphyra
Species: Porphyra purpurea
Sample Collection
Ocean:
Country: Canada
State: Quebec
Region:
Exact Site: Riviere du Loup
Latitude: 47.8494
Longitude: -69.5489
Coordinate: FlashEarth
Collectors: H. Kucera
Collectiondate: 2006-08-26
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2397-08
Marker Code: COI-5P
Residues: 664
TACCTTATATTTAATTTTTGGTGCATTCTCTGGTGTTCTAGGTGCCTGCGCATCCATATTAATCAGGATGGAGCTAGCCCAACCAGGTAATCAACTCCTTTTAGGTAACCATCAAGTTTATAATGTCTTAGTTACAGAGCACGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTACTAATAGGAGGGTTTGGTAATTGATTTGTGCCAATTATGATAGGAGCACCAGATATGGCATTCCCTCGATTAAATAACATTAGTTTTTGATTATTACCCCCATCACTATGTCTGCTCTTAGGATCCGCTATGGTTGAAGTAGGGGCAGGCACGGGCTGAACATTGTATCCACCGCTAAGTTCTATTCAAAGTCATTCTGGTGGCGCTGTTGATTTAGCTATCTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTAGGTGCTATTAACTTCATTACTACTATATTCAACATGCGTAACCCAGGACAAAGTATGTACCGTATCCCATTATTTGTGTGGTCTATCTTAATCACGGCTTTTTTATTGTTACTAGCTGTTCCTGTATTAGCAGGTGCTATTACAATGTTGCTTACCGATAGAAACTTCAATACCACATTTTTCGATCCGTCAGGTGGTGGAGATCCTGTGTTGTATCAACACTTGTTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.