Specimen Information

Sample Storage
Sample ID: GWS008014
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Porphyra
Species: Porphyra purpurea
Sample Collection
Ocean:
Country: Canada
State: New Brunswick
Region:
Exact Site: Pointe Sapin, Northumberland Straight
Latitude: 46.96
Longitude: -64.83
Coordinate: FlashEarth
Collectors: L. LeGall, H. Kucera & J. Utge
Collectiondate: 2006-08-17
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2391-08
Marker Code: COI-5P
Residues: 664
TACCTTATATTTAATTTTTGGTGCATTCTCTGGTGTTCTAGGTGCCTGCGCATCCATATTAATCAGGATGGAGCTAGCCCAACCAGGTAATCAACTCCTTTTAGGTAACCATCAAGTTTATAATGTCTTAGTTACAGAGCACGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTACTAATAGGAGGGTTTGGTAATTGATTTGTGCCAATTATGATAGGAGCACCAGATATGGCATTCCCTCGATTAAATAACATTAGTTTTTGATTATTACCCCCATCACTATGTCTGCTCTTAGGATCCGCTATGGTTGAAGTAGGGGCAGGCACGGGCTGAACATTGTATCCACCGCTAAGTTCTATTCAAAGTCATTCTGGTGGCGCTGTTGATTTAGCTATCTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTAGGTGCTATTAACTTCATTACTACTATATTCAACATGCGTAACCCAGGACAAAGTATGTACCGTATCCCATTATTTGTGTGGTCTATCTTAATCACGGCTTTTTTATTGTTACTAGCTGTTCCTGTATTAGCAGGTGCTATTACAATGTTGCTTACCGATAGAAACTTCAATACCACATTTTTCGATCCGTCAGGTGGTGGAGATCCTGTGTTGTATCAACACTTGTTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.