Specimen Information

Sample Storage
Sample ID: GWS006577
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Wildemania
Species: Wildemania amplissima
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Tahsis Nuchatliz Island, (#37 on Esperenza Inlet Chart)
Latitude: 49.8101
Longitude: -126.982
Coordinate: FlashEarth
Collectors: B. Clarkston, D. McDevit, K. Roy & S. Hamsher
Collectiondate: 2007-05-30
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC2361-08
Marker Code: COI-5P
Residues: 664
AACATTATACCTAATATTTGGTGCTTTTTCTGGTATATTAGGTGCGTGTGCATCTATATTGATCAGGATGGAACTAGCCCAACCAGGTAATCAATTATTATTAGGAAATCACCAAGTCTACAACGTGTTAGTTACTGAGCATGCTTTCTTAATGATTTTTTTTATGGTAATGCCTGTCTTAATCGGAGGTTTTGGTAATTGGTTTGTACCGATCATGATCGGAGCTCCTGATATGGCGTTTCCCCGATTAAATAATATTAGTTTTTGATTGCTACCTCCTTCATTATGTCTTCTTTTAGGTTCTGCTATGGTAGAAGTAGGTGCAGGTACAGGATGAACTTTATATCCTCCATTAAGCTCAATTCAGAGCCATTCGGGCGGCGCTGTAGATTTAGCCATTTTCAGTTTGCATTTATCAGGAGCATCTTCAATATTAGGCGCTATTAATTTTATTACGACTATATTTAATATGCGTAATCCAGGACAAAGTATGTACCGCATACCTTTATTTGTCTGATCCATTTTAATCACAGCTTTTTTACTTTTATTAGCAGTACCCGTGTTAGCAGGCGCTATTACAATGTTACTAACAGACAGGAATTTTAATACTACATTCTTTGATCCGTCAGGTGGTGGTGACCCCGTTCTGTATCAGCATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!