Specimen Information

Sample Storage
Sample ID: GWS005848
Catalog Number: GWS005848
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia perforata
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Bamfield, Bradys Beach
Latitude: 48.824
Longitude: -125.162
Coordinate: NULL
Collectors: H. Kucera and D. Riddell
Collectiondate: 2006-12-29
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1706-07
Marker Code: COI-5P
Residues: 664
AACTTTATATTTAATTTTTGGCGCTTTTTCCGGCATATTAGGTGCATGTGCATCTATATTAATCAGAATGGAATTAGCTCAACCTGGTAATCAATTATTGTTAGGTAATCATCAAATATACAATGTACTTGTGACGGAACATGCTTTCCTAATGATTTTTTTCATGGTTATGCCTGTATTAATTGGCGGATTTGGTAACTGATTCGTACCAATCATGATAGGTGCTCCAGATATGGCATTTCCTCGTTTAAATAATATAAGTTTCTGGTTATTACCGCCATCATTATGTCTTCTTTTAGGATCTGCCATGGTAGAAGTGGGTGCAGGTACAGGTTGAACTCTATATCCACCTTTAAGTTCTATACAAAGTCATTCAGGGGGGGCTGTAGACCTTGCTATTTTTAGTTTGCATCTATCTGGTGCTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACTATATTTAACATGCGTAATCCAGGACAAAGTATGTATCGTATACCTCTATTTGTTTGATCTATACTCATAACTGCTTTTTTATTACTACTTGCAGTGCCTGTTTTAGCTGGCGCCATTACCATGTTATTAACAGATAGAAACTTCAACACTACATTTTTCGACCCTTCAGGTGGTGGAGATCCTGTGCTTTATCAGCATCTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.