Specimen Information

Sample Storage
Sample ID: GWS005808
Catalog Number: GWS005808
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Hana Kucera
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Porphyra
Species: Porphyra mumfordii
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Bamfield, Aguilar Point
Latitude: 48.837
Longitude: -125.144
Coordinate:
Collectors: H. Kucera and D. Riddell
Collectiondate: 2006-12-28
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1692-07
Marker Code: COI-5P
Residues: 664
TACTTTATATTTGATTTTTGGCGCATTTTCTGGTATTCTAGGTGCATGTGCATCAATATTAATTAGGATGGAACTAGCTCAACCAGGTAACCAACTGCTTTTAGGAAATCATCAAATTTATAACGTATTAGTCACAGAGCATGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTATTAATAGGCGGGTTTGGTAATTGATTTGTACCTATTATGATAGGTGCACCAGACATGGCATTTCCTCGATTAAATAATATTAGTTTTTGATTATTACCCCCATCATTATGTCTTCTTTTAGGGTCAGCTATGGTTGAAGTAGGAGTAGGAACAGGTTGAACATTGTATCCCCCACTAAGTTCTATTCAAAGTCACTCTGGAGGAGCCGTTGATCTAGCTATTTTTAGTTTGCATCTATCGGGAGCTTCTTCTATACTTGGCGCTATTAATTTTATTACTACCATATTCAATATGCGCAATCCAGGGCAAAGTATGTACCGTATTCCATTATTTGTCTGATCGATCTTAATTACAGCTTTTCTGTTGTTATTAGCCGTTCCTGTATTAGCAGGTGCTATCACAATGTTACTCACGGATAGAAATTTTAATACCACATTTTTTGATCCTTCAGGCGGAGGTGACCCTCTTTTATATCAACATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!