Specimen Information

Sample Storage
Sample ID: GWS005191
Catalog Number: GWS005191
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gary Saunders
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Wildemania
Species: Wildemania miniata
Sample Collection
Ocean:
Country: Canada
State: New Brunswick
Region:
Exact Site: Riding`s Rock, Meadow Cove
Latitude: 45.103
Longitude: -66.388
Coordinate:
Collectors: GWS & B. Clarkston
Collectiondate: 2006-08-02
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1688-07
Marker Code: COI-5P
Residues: 664
TACATTGTATTTAATTTTTGGTGCTTTTTCTGGAATACTCGGTGCCTGCGCATCTATATTAATTAGAATGGAATTAGCTCAACCAGGTAATCAATTATTATTAGGTAACCATCAAGTCTACAATGTATTAGTGACTGAGCATGCTTTTCTAATGATTTTTTTTATGGTAATGCCAGTACTAATAGGAGGTTTTGGTAACTGATTTGTACCTATTATGATAGGAGCTCCTGATATGGCGTTTCCTAGGTTAAATAATATCAGTTTTTGATTATTGCCTCCCTCATTGTGTCTTCTTTTAGGTTCTGCTATGGTAGAAGTTGGAGCAGGCACAGGTTGAACGCTATATCCTCCATTAAGCTCAATCCAAAGTCACTCAGGGGGAGCTGTAGACCTTGCTATATTTAGTTTGCATTTATCAGGAGCATCTTCAATATTAGGCGCGATTAATTTTATTACGACCATATTTAACATGCGTAATCCAGGGCAAAGTATGTATCGTATACCTTTATTTGTTTGATCTATCCTAATTACAGCGTTTTTGCTTTTATTAGCAGTACCTGTGTTAGCAGGTGCAATTACAATGTTACTAACAGATAGAAACTTTAATACTACATTTTTTGACCCTTCCGGAGGAGGTGACCCTGTGCTATATCAGCATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.