Specimen Information

Sample Storage
Sample ID: GWS001869
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Bangia
Species: Bangia fuscopurpurea
Sample Collection
Ocean:
Country: United States
State: Rhode Island
Region:
Exact Site: Brenton Pt., Newport
Latitude: 41.449
Longitude: -71.356
Coordinate: NULL
Collectors: Gary Saunders & R. Withall
Collectiondate: 2003-10-05
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1273-07
Marker Code: COI-5P
Residues: 664
TACACTATATTTGATTTTCGGAGCATTTTCTGGCATTTTAGGTGCTTGTGCTTCAATTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAATTGTTATTAGGTAATCATCAAGTTTATAATGTGTTAGTAACCGAGCATGCTTTTTTAATGATCTTTTTCATGGTGATGCCTGTACTTATCGGAGGATTTGGCAATTGATTTGTACCTATTATGATAGGAGCACCTGATATGGCTTTTCCTAGATTAAATAATATTAGTTTTTGATTATTGCCTCCGTCACTATGTCTTCTTTTAGGGTCAGCTATGGTCGAAGTAGGTGCAGGAACAGGCTGAACTTTATATCCACCATTAAGTTCTATTCAGAGTCATTCAGGAGGGGCTGTAGATCTTGCTATCTTTAGTTTACACTTGTCGGGAGCTTCTTCTATATTAGGAGCTATTAATTTTATTACTACTATATTTAACATGCGCAATCCAGGTCAAAGTATGTATAGAATCCCATTGTTTGTGTGGTCTATTTTAATCACTGCTTTTTTACTACTATTAGCAGTTCCTGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGATAGAAACTTCAATACTACTTTTTTTGATCCTTCTGGAGGTGGGGACCCTGTATTATATCAACATCTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.