Specimen Information

Sample Storage
Sample ID: LLG007
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Boreophyllum
Species: Boreophyllum birdiae
Sample Collection
Ocean:
Country: Canada
State: Nova Scotia
Region:
Exact Site: Little Anse, Isle Madame, Cape Breton
Latitude: 45.492
Longitude: -60.925
Coordinate: NULL
Collectors: L. LeGall
Collectiondate: 2004-08-29
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1258-07
Marker Code: COI-5P
Residues: 664
TACGTTGTATTTAATTTTTGGGGCATTCTCTGGAATGTTAGGTGCCTGTGCATCAATACTAATTAGAATGGAATTAGCCCAACCTGGTAACCAACTTTTATTGGGAAATCATCAAGTGTACAATGTGCTAGTTACAGAGCATGCGTTCTTAATGATATTCTTTATGGTAATGCCAGTACTGATTGGGGGATTTGGTAACTGGTTTGTACCTATTATGATAGGAGCTCCAGACATGGCATTTCCTAGATTAAATAATATAAGTTTCTGGCTGTTACCTCCTTCGTTATGCCTACTTCTAGGATCTGCCATGGTCGAAGTCGGTGCTGGTACAGGCTGAACTTTGTATCCTCCATTGAGCTCGATTCAAAGTCACTCTGGAGGTGCTGTAGATTTAGCCATATTTAGTTTACATTTATCAGGCGCTTCTTCAATACTCGGCGCTATTAATTTTATTACTACGATATTTAATATGCGTAATCCTGGGCAAAGCATGTATCGCATACCATTATTCGTCTGATCCATTTTAATCACTGCTTTCCTACTCTTATTAGCCGTACCAGTATTAGCTGGGGCGATCACAATGTTATTAACAGACAGAAATTTCAATACTACCTTTTTTGATCCTTCGGGGGGTGGTGATCCCGTATTGTATCAGCACTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.