Specimen Information

Sample Storage
Sample ID: LLG0037
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia njordii
Sample Collection
Ocean:
Country: Canada
State: Quebec
Region:
Exact Site: Off Discovery Centre, Les Escoumins
Latitude: 48.35
Longitude: -69.417
Coordinate: NULL
Collectors: L. LeGall
Collectiondate: 2004-09-29
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1257-07
Marker Code: COI-5P
Residues: 664
TACTTTATATTTAATTTTTGGCGCTTTTTCTGGCATACTAGGTGCATGCGCATCTATATTGATTAGAATGGAATTAGCACAACCGGGTAACCAACTTTTGCTAGGGAACCATCAAGTATATAATGTACTAGTTACAGAGCATGCATTTTTAATGATCTTTTTCATGGTTATGCCTGTATTAATTGGAGGCTTTGGTAATTGATTTGTACCAATTATGATAGGAGCGCCAGACATGGCTTTTCCAAGATTAAATAACATAAGTTTTTGATTGCTACCTCCGTCATTATGTCTTCTTTTAGGATCTGCTATGGTTGAAGTAGGCGCTGGGACAGGATGAACTTTATATCCTCCTTTAAGCTCTATCCAAAGTCATTCAGGTGGCGCTGTAGATCTTGCTATTTTTAGTTTGCATTTATCAGGGGCCTCTTCTATATTGGGAGCTATTAATTTTATTACTACTATATTTAATATGCGTAATCCAGGTCAAAGTATGTATCGCATACCTTTATTTGTTTGATCTATATTAATAACAGCTTTCTTATTGTTATTAGCAGTACCTGTCTTAGCTGGTGCTATTACAATGTTACTAACAGATAGAAATTTTAATACCACATTTTTTGATCCTTCCGGTGGTGGTGATCCTGTATTGTATCAGAATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!