Specimen Information

Sample Storage
Sample ID: GWS003793
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Porphyra
Species: Porphyra umbilicalis
Sample Collection
Ocean:
Country: Canada
State: New Brunswick
Region:
Exact Site: Meadow Cove exposed biodiversity site, Bay of Fundy
Latitude: 45.038
Longitude: -66.891
Coordinate:
Collectors: H. Kucera
Collectiondate: 2006-05-28
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1243-07
Marker Code: COI-5P
Residues: 664
TACTCTATATTTGATTTTTGGCGCATTTTCTGGTATTCTAGGTGCGTGTGCATCAATATTAATTAGGATGGAACTAGCTCAACCAGGCAACCAATTGCTTTTAGGAAATCATCAAATTTATAATGTATTAGTCACAGAGCATGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTATTAATAGGCGGGTTTGGTAATTGATTTGTACCTATTATGATAGGTGCACCAGACATGGCATTTCCTCGATTAAATAATATTAGTTTTTGATTATTACCCCCATCACTATGTCTTCTTTTAGGGTCAGCTATGGTTGAAGTAGGAGTAGGAACAGGTTGAACATTATATCCCCCACTAAGTTCTATTCAAAGTCACTCTGGAGGAGCCGTTGATCTAGCTATTTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTTGGTGCTATTAATTTTATTACTACCATATTCAATATGCGCAATCAAGGGCAAAGTATGTACCGTATTCCATTATTTGTCTGGTCTATCTTAATTACAGCTTTTCTGTTGTTATTAGCCGTTCCTGTATTAGCGGGTGCTATTACAATGTTACTCACGGATAGAAATTTTAATACCACATTTTTTGATCCTTCAGGTGGAGGTGACCCCGTTTTATATCAACATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!