Specimen Information

Sample Storage
Sample ID: GWS003769
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia leucosticta
Sample Collection
Ocean:
Country: Canada
State: New Brunswick
Region:
Exact Site: Harrington Cove exposed biodiversity site, Grand Manan
Latitude: 44.625
Longitude: -66.86
Coordinate:
Collectors: H. Kucera
Collectiondate: 2006-05-27
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1241-07
Marker Code: COI-5P
Residues: 664
TACTTTATATTTAATTTTTGGCGCTTTCTCTGGTATCTTAGGTGCTTGCGCGTCTATATTGATCAGAATGGAACTCGCACAACCAGGTAACCAACTATTATTAGGAAATCATCAAGTGTATAACGTACTGGTTACAGAGCACGCATTTTTGATGATTTTTTTCATGGTTATGCCCGTCCTAATTGGAGGATTTGGAAACTGATTTGTGCCTATTATGATAGGTGCTCCAGATATGGCCTTCCCTAGATTAAATAATATAAGTTTTTGATTACTGCCTCCATCACTGTGTCTCCTTCTAGGATCTGCGATGGTAGAAGTTGGTGCTGGCACAGGTTGAACCTTATATCCGCCTTTGAGCGCTATTCARAGTCATTCAGGGGGTGCTGTCGATCTTGCTATTTTTAGTTTACACTTGTCAGGTGCTTCTTCTATATTAGGAGCGATTAATTTTATTACTACAATATTCAATATGCGCAATCCAGGACAAAGTATGTATCGAATACCTCTATTTGTTTGATCTATCCTTATTACTGCATTTCTTTTATTATTAGCAGTACCTGTCTTGGCAGGGGCTATCACAATGCTGTTAACAGACAGAAACTTTAACACGACATTTTTTGACCCTTCAGGTGGTGGTGATCCTGTATTGTATCASCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!