Specimen Information

Sample Storage
Sample ID: GWS003638
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia leucosticta
Sample Collection
Ocean:
Country: United States
State: Maine
Region:
Exact Site: End of public road, Starboard
Latitude: 44.609
Longitude: -67.397
Coordinate:
Collectors: Gary Saunders, L. LeGall, D. McDevit, S. Clayden & C. Lane
Collectiondate: 2006-04-25
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1226-07
Marker Code: COI-5P
Residues: 664
TACTTTATATTTAATTTTTGGCGCTTTCTCTGGTATCTTAGGTGCTTGCGCGTCTATATTGATCAGAATGGAACTCGCACAACCAGGTAACCAACTATTATTAGGAAATCATCAAGTGTATAACGTACTGGTTACAGAGCACGCATTTTTGATGATTTTTTTCATGGTTATGCCCGTCCTAATTGGAGGATTTGGAAACTGATTTGTGCCTATTATGATAGGTGCTCCAGATATGGCCTTCCCTAGATTAAATAATATAAGTTTTTGATTACTGCCTCCATCACTGTGTCTCCTTCTAGGATCTGCGATGGTAGAAGTTGGTGCTGGCACAGGTTGAACCTTATATCCGCCTTTGAGCGCTATTCAGAGTCATTCAGGGGGTGCTGTCGATCTTGCTATTTTTAGTTTACACTTGTCAGGTGCTTCTTCTATATTAGGAGCGATTAATTTTATTACTACAATATTCAATATGCGCAATCCAGGACAAAGTATGTATCGAATACCTCTATTTGTTTGATCTATCCTTATTACTGCATTTCTTTTATTATTAGCAGTACCTGTCTTGGCAGGGGCTATCACAATGCTGTTAACAGACAGAAACTTTAACACGACATTTTTTGACCCTTCAGGTGGTGGTGATCCTGTATTGTATCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!