Specimen Information

Sample Storage
Sample ID: GWS022083
Catalog Number: GWS022083
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Bridgette E. Clarkston
Taxonomy
Phylum: Rhodophyta
Class: Compsopogonophyceae
Order: Erythropeltidales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: United States
State: California
Region:
Exact Site: Stillwater Cove, Pebble Beach
Latitude: 36.567
Longitude: -121.943
Coordinate:
Collectors: B. Clarkston, K. Hind & S. Toews
Collectiondate: 2010-05-20
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC12247-10
Marker Code: COI-5P
Residues: 664
AACGTTATACTTAATTTTTGGTGCTTTCTCTGGAGTGTTAGGCACAGTACTTAGTGTAATTATACGTATGGAATTAGCACATCCTGGCTCACAAATTTTAGCAGGAAATTATCAACTGTACAATGTTTTAATTACTAGTCATGCTTTTCTTATGATCTTTTTTTTCGTAATGCCTATAATGATAGGAGGGTTTGGTAATTGATTCGTACCTATAATGATAGGCGCTCCAGATATGGCGTTTCCAAGATTAAACAACATATCTTTTTGACTATTACCGCCTGCGCTTGTACTTTTGTTAACTTCATCACTCGTTGAATTTGGTGCTGGAACGGGGTGAACTGTTTATCCACCTTTAAGTGCGATTCAAAGTCATTCCGGAGGAGCTATCGAACTTTGTATCTTGTCTCTTCATATTGCAGGTGCAAGTTCTATCTTAGGAGCTGTAAACTTTATTGTTACCATATTAAATATGAGAAATCCAGGCCAAGGGTATCATCGAATGCCTTTATTTGTATGATCTATATTAATTACAGCAATTTTGTTACTATTAGCAGTTCCTGTGCTTGCAGGTGCAATTACAATGTTATTAACTGATCGTAACTTTAATACAATGTTTTTTGATGCTAAAGGAGGAGGAGACCCTATACTATATCAACATCTCTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.