Specimen Information

Sample Storage
Sample ID: GWS003418
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia smithii
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: Pachena Beach, Bamfield
Latitude: 48.786
Longitude: -125.119
Coordinate:
Collectors: Gary Saunders, B. Clarkston & D. McDevit
Collectiondate: 2006-06-12
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1223-07
Marker Code: COI-5P
Residues: 664
TACTCTATATTTAATTTTTGGCGCTTTTTCTGGTATATTAGGTGCATGTGCATCTATATTGATTAGAATGGAATTAGCGCAACCTGGAAATCAACTTTTGTTAGGCAATCATCAAATATACAATGTATTAGTTACAGAACATGCATTTTTAATGATATTTTTTATGGTTATGCCTGTATTAATTGGCGGATTTGGGAATTGGTTTGTACCAATTATGATCGGTGCGCCAGATATGGCTTTTCCAAGGTTAAATAACATAAGTTTTTGATTGTTACCTCCATCATTATGCCTTCTTTTAGGGTCTGCTATGGTTGAAGTTGGTGCTGGTACAGGTTGGACTTTGTATCCTCCTTTAAGTTCTATACAAAGTCATTCAGGTGGTGCTGTAGATCTTGCTATTTTTAGTTTGCATTTATCAGGTGCTTCTTCTATATTAGGTGCTATAAACTTTATTACTACCATATTTAACATGCGTAATCCAGGTCAAAGCATGTATCGTATACCTTTATTTGTCTGGTCTATATTAATCACAGCTTTTTTACTGTTATTAGCAGTACCTGTTTTAGCTGGTGCTATTACAATGTTATTAACGGATAGAAATTTTAATACTACATTTTTTGATCCTTCTGGTGGTGGTGATCCTGTGTTGTATCASCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!