Specimen Information

Sample Storage
Sample ID: GWS002660
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Rhodophyta
Class: Bangiophyceae
Order: Bangiales
Family: Bangiaceae
Genus: Pyropia
Species: Pyropia peggicovensis
Sample Collection
Ocean:
Country: Canada
State: Nova Scotia
Region:
Exact Site: Peggys Cove, Halifax Co.
Latitude: 44.49
Longitude: -63.917
Coordinate: NULL
Collectors: Gary Saunders
Collectiondate: 2005-03-26
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABMMC1216-07
Marker Code: rbcL
Residues: 1363
TTACTGGGATGCTGACTATGTAATTAAAGAAACAGATATTTTAGCTCTGTTCAGAATCACTCCTCAGCCAGGTGTTGACCCTATTGAAGCATCCGCTGCAATTGCAGGTGAATCTTCAACAGCTACTTGGACAGTTGTATGGACTGATTTGCTAACAGCTTGTGACCTATACAGAGCAAAAGCGTATCGAGTTGATCCAGTTCCAAATGTTGCAGATCAATACTTTGCTTACATCGCTTATGATATTGATTTATTTGAAGAAGGTTCCATTGCGAATTTAACTGCTTCAATTATTGGTAACGTTTTTGGATTTAAAGCTGTAAAAGCTCTTCGTCTAGAAGATATGCGTATGCCAGTAGCTTACCTAAAAACTTTCCAAGGTCCTGCAACTGGATTGATTGTAGAACGTGAGCGTATGGATAAATTTGGTAGACCTTTCCTAGGTGCTACGGTTAAACCTAAACTAGGTTTATCTGGTAAAAACTATGGAAGAGTAGTATATGAAGGTCTGAAAGGTGGTCTTGACTTCCTTAAAGATGATGAAAATATCAACTCACAACCATTTATGCGTTGGAGAGAAAGATTCCTATATTCCATGGAAGGTGTAAATAAAGCATCTGCTTCTGCTGGAGAAATTAAAGGTCATTACCTTAACGTAACAGCTGCGACTATGGAAGATATGTACGAGAGAGCAGAATTCTCCAAGGACGTTGGTAGCATCATTTGTATGATTGACCTTGTAATTGGTTATACTGCGATTCAAAGTATGGCAATCTGGGCTCGTAAGCATGATATGATTTTACATTTACATAGAGCAGGTAACTCTACTTACTCTCGTCAAAAAAATCATGGTATGAACTTCCGAGTTATTTGCAAATGGATGCGTATGGCAGGTGTTGACCATATTCACGCAGGTACAGTTGTAGGTAAACTTGAGGGAGATCCTTTAATGATTAAAGGTTTCTACAACACTTTACTTGAAAGTGATACAGATATCAATCTACCTCAAGGTCTATTCTTTGCTCAAAACTGGGCTTCCCTACGTAAAGTTGTACCAGTAGCATCTGGTGGTATTCATGCTGGTCAAATGCACCAACTTCTTGATTACCTAGGCGATGATGTAGTTCTTCAGTTTGGTGGTGGTACAATTGGACATCCTGATGGTATCCAAGCAGGAGCAACTGCAAACAGAGTAGCATTAGAGTCCATGGTTATGGCAAGAAATGAAGGTCGCAATTATGTAGCAGAAGGTCCACAAATCTTAAGAGACGCTGCTAAAACTTGTGGACCTCTACAAACAGCTTTAGATTTATGGAAAGATATTAGTTTTAACTATACTTCCACAGATACAGCTGATTTCGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!