Specimen Information

Sample Storage
Sample ID: ROM 108413
Catalog Number: 108413
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Mammalia
Order: Chiroptera
Family: Phyllostomidae
Genus: Artibeus
Species: Artibeus lituratus
Sample Collection
Ocean:
Country: Guyana
State: Potaro-Siparuni
Region:
Exact Site:
Latitude: 4.367
Longitude: -58.85
Coordinate:
Collectors: Lim, BK; Scully, WMR; Arjoon, JD; Jafferally, DM
Collectiondate: 1997-10-05
Specimen Details
Sex: female
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ABGYD115-06
Marker Code: COI-5P
Residues: 657
ACTTTATACCTATTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGAGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCCGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTTGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCCTTATTTGTCTGATCTGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCTGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCCATTTTATATCAACACTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!