Specimen Information

Sample Storage
Sample ID: AASFB-0409
Catalog Number: AA-0819
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Mexico
State: Quintana Roo
Region: Othon P. Blanco
Exact Site: Chetumal, El Itzmeno Ranch
Latitude: 18.553
Longitude: -88.399
Coordinate:
Collectors: J. Cahuich
Collectiondate: 2008-10-20
Specimen Details
Sex: female
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AASFB409-10
Marker Code: COI-5P
Residues: 658
AACTTTATATTTACTTTTTGGAGTTTGATCAGCTATGGTTGGTACAGCTATAAGTGTTTTAATTCGTATAGAATTAGGTCGTCCTGGAAGATTTTTAGGTGATGATCATTTATATAATGTAATAGTAACTGCTCATGCTTTTGTGATAATTTTTTTTATAGTTATGCCAATTTTAATTGGTGGGTTTGGAAATTGGTTAGTTCCTTTAATATTAGGAGCTCCGGATATATCATTTCCTCGAATAAATAATTTATCTTTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATAGTTGAAGTAGGAGTAGGAGCAGGATGAACTGTTTATCCTCCGTTAGCTTCTACTGTGGGTCATATAGGAAGATCAATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGGGCTTCTTCAATTATAGGGGCTATTAATTTTATTTCTACTATTATTAATATACGTTCGGTTGGTATAAGAATAGAAAAGGTACCTTTATTTGTTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCAATTTTATTTCAACATCTTTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!