Specimen Information

Sample Storage
Sample ID: AASFB-0325
Catalog Number: AA-0463
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: G. Alayon
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Mexico
State: Quintana Roo
Region: Othon P. Blanco
Exact Site: Tomas Garrido
Latitude: 18.019
Longitude: -89.068
Coordinate:
Collectors: M. Tuz
Collectiondate: 1994-04-01
Specimen Details
Sex: female
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AASFB325-10
Marker Code: COI-5P
Residues: 658
CACTTTATATTTGGTATTTGGGGCTTGGGCAGCTATAGTTGGGACAGGAATAAGAGTTTTAATCCGTATAGAATTAGGTCAGGTGGGAAGATTTCTAGGTAATGATCAGTTGTACAATGTTATTGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAGTTTTAATTGGGGGGTTTGGAAATTGGTTAGTGCCACTAATATTAGGGGCTCCTGATATAGCGTTTCCTCGGATAAATAATTTAAGTTTTTGATTACTTCCCCCTTCTTTTATGCTTTTATTGATTTCTTCTATAGTGGAAGTAGGGGTAGGGGCTGGTTGAACTGTGTATCCCCCCCTTTCGTCATTAGATGGGCATTCAGGTAGTGCGGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCATCTATTATGGGGGCTATTAATTTTATTTGTACAATTTTAAATATACGAATATGAGGTATAACAATAGAAAAGGTCCCCCTCTTCGTTTGATCTGTTTTAGTAACGGCTGTTCTTTTATTATTATCTTTGCCTGTTCTTGCCGGAGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCAGGGGGGGGAGATCCTGTATTGTTTCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.