Specimen Information

Sample Storage
Sample ID: ANIC Gen No. 004274
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Edward D. Edwards
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Australia
State: Western Australia
Region:
Exact Site: Lake Muir Rd, Talling SF
Latitude: -34.26
Longitude: 116.38
Coordinate:
Collectors: A. Zwick
Collectiondate: 2003-11-03
Specimen Details
Sex:
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AANIC153-10
Marker Code: COI-5P
Residues: 658
AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATGATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCACCTTCTATTATTTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTCTATCCTCCTTTATCTTCTAATATTGCCCATAGAGGAAGATCAGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGGGCTATTAATTTTATTACAACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCCTTACCAGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!