Specimen Information

Sample Storage
Sample ID: AAD-57912
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Mollusca
Class: Gastropoda
Order: Hypsogastropoda
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Antarctica
State:
Region: Australian Antarctic Territory, Prince Elizabeth Land
Exact Site: Davis-STP14B
Latitude: -68.547
Longitude: 77.984
Coordinate: -68.547
Collectors: AAD Dive Team
Collectiondate: 2010-03-08
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AADBE237-10
Marker Code: COI-5P
Residues: 647
ACACTATATATTTTATTTGGTATATGATCAGGACTTGTTGGAACTGCTTTAAGTCTTCTTATTCGAGCTGAACTTGGGCAACCTGGAGCCCTTTTAGGGGATGATCAGTTATACAATGTTATTGTAACAGCCCATGCTTTTGTTATAATTTTTTTTTTAGTTATGCCCATAATAATTGGGGGTTTTGGAAACTGGTTAGTGCCTTTAATGTTAGGTGCTCCAGATATAGCTTTTCCTCGACTTAATAATATAAGATTTTGGTTGCTTCCTCCTGCGTTATTATTATTACTATCTTCAGCTGCTGTAGAAAGGGGGGCTGGAACTGGATGGACTGTATATCCCCCTCTTTCTGGTAATTTAGCTCATGCCGGAGGATCTGTAGATCTTGCAATTTTTTCTTTACATCTAGCAGGTGTTTCTTCTATTCTGGGAGCAGTAAACTTTATTACAACTATTATTAACATGCGTTGACGTGGAATGCAGTTTGAACGGCTTCCTTTATTTGTATGGTCTGTAAAGATTACAGCTATTCTTCTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTTAATACAGCTTTTTTTGATCCAGCCGGAGGTGGAGATCCTATTTTATACCA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!